An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
Ugh it didn’t blast or translate
EMBOSS_001_1
NVIALPVGTX
EMBOSS_001_2
TSPDYQVLX
EMBOSS_001_3
RHSLITSRY
EMBOSS_001_4
STYW*SGYDV
EMBOSS_001_5
YLLVIRLRX
EMBOSS_001_6
LVPTGNQAMTXOut of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?
If “reading” the sequence, it sounds similar to Mr Krab’s laugh
I wonder if theoretically you could share humans through the internet? Share your sequence and someone can download it and build it with a theoretical machine. Would probably be a few Petabytes of data though like you can see in that Black Mirror episode with that spaceship.
If we ignore the mutations in the life of an individual, it would actually only be a few hundreds megabytes. Or if we already have a template of a human genome and we only code the difference between them and the human we want to copy, a few megabytes is enough since we all share A LOT of sequences
ya I’ve kind of been wondering if with how foods and random mutations affect dna I doubt you could use baby you dna to get an adult that actually looks exactly like you
There is also epigenetic modifications to be considered
Oh cool I didn’t know that stuff, it’s super interesting
It bottles the mind.
The future of onlyfans products
